Abstract
Larvae of the black soldier fly (Hermetia illucens, BSFL) are rich in valuable nutrients and offer a promising alternative protein source for animal feeds. Nonetheless, there is a pressing need to improve both the productivity and quality of BSFL to ensure the viability of BSFL products and facilitating the industrial production. To fulfil the needs of different animals, it is necessary to adjust the profile of essential amino acids (EAAs) in BSFL. Insects excrete surplus nutrients to maintain homeostasis; AAs are excreted by nutrient AA transporters (NATs) in the Malpighian tubules. We aimed to modify the composition of essential AAs by silencing the NAT in Malpighian tubules of BSFL (HiNATt). Silencing HiNATt resulted in a 77.3% increase in the total AA content while 56.2% decrease in body weight. Notably, the contents of some valuable essential AAs were strongly increased (histidine, 256.8%; valine, 198.1% in total compared to the intact larva). These results suggest that inhibiting the HiNATt function could modify the amount of accumulated EAAs. This finding opens a new avenue for producing BSFL with increased nutritional value as an alternative protein source.
1 Introduction
Insects are considered a promising alternative protein source for food and feed owing to their high protein content; their production also has a lower land footprint and generates fewer greenhouse gas emissions than that of conventional protein sources (Parodi et al., 2018). For instance, black soldier fly (BSF) larvae (BSFL), Hermetia illucens (Diptera: Stratiomyidae), consume a wide range of organic wastes and efficiently transform them into high-quality protein. The potential of using BSFL meal as a substitute for fishmeal in the diets of laying hens and broiler chickens has been reported (Attivi et al., 2020, 2022; Biasato et al., 2019; Chia et al., 2021). Recently, the use of BSF products in livestock and aquaculture feed has been approved by the European Union (EU, 2021). However, reduced digestibility and lower levels of AAs, in particular methionine and cysteine, and the amino acid (AA) composition of BSF differs from that of fishmeal and may need to be adjusted (Lu et al., 2022; Nogales-Mérida et al., 2019). Such scores may decrease fish performance and consequently the willingness of growers to use BSF meal as an alternative protein source.
Nutritive value, especially the AA composition, of BSFL can be adjusted by formulating the ingredients in their diet (Abd El-Hack et al., 2020; Gold et al., 2018; Lalander et al., 2019; Liland et al., 2017; Nogales-Mérida et al., 2019; Schiavone et al., 2017; Wang and Shelomi, 2017; Zulkifli et al., 2022). For instance, the total protein content and the content of individual AAs, except isoleucine, cysteine, methionine, and tryptophan, is significantly affected by seasonal diet (Fuso et al., 2021). Furthermore, BSFL fed on a high ratio of protein and carbohydrate could increase the protein yield of BSFL, with some trade-off effects on larval performance when the protein content exceeds 10% (Barragan-Fonseca et al., 2021; Tschirner and Simon, 2015). However, preparing a specific diet for BSFL may undermine the advantages of this insect which can convert various wastes into proteins. Synthetic AAs are usually used as supplements to adjust the AA content in livestock and aquaculture feed; however, the higher absorption rate of these additional AAs might result in certain effects on the performance of animals (Yamamoto et al., 2019). Therefore, novel approaches are needed for adjusting the AA content or composition of BSFL through breeding or biotechnology methods.
The digestive system in the larva of black soldier fly, Hermetia illucens. (left) The process of protein digestion. (center) The function of nutrient amino acid transporters (NATs). (right) The core idea of this study: to accumulate amino acids by manipulating their transport.
Citation: Journal of Insects as Food and Feed 2024; 10.1163/23524588-00001155
Manipulating AA metabolism pathways may be an intuitive approach to adjust AA content or composition. However, these metabolic pathways are typically intricate and challenging to finely adjust for AA composition. In addition, the operation of certain AA metabolism pathways may not work because some important enzymes are missing. For example, the histidine ammonia-lyase is absent in Dipteran insects (Zdobnov et al., 2002). Instead of AA metabolism, we considered retaining the AAs by manipulating the excretion of AAs in BSFL. The Malpighian tubules are excretory organs that collect waste and excess nutrients from the haemolymph and send them to the hindgut. In this process, nutrient AA transporters (NATs), a sub-family of solute carriers (SLCs), transport AAs across cell membranes coupled with Na+ and Cl− transport (Figure 1). In metazoans, 10 SLC families are involved in AA transport, and the SLC6 and SLC7 families include major AA transporters (Boudko, 2012). Information available on SLC7 is limited, so we focused on the SLC6 family and used transcriptome analysis to identify candidate NATs in BSFL. This study aimed to identify NATs in the Malpighian tubules, suppress their expression, and evaluate the resulting changes in AA composition. Our findings could pave the way for the development of a novel approach to producing BSF strains with increased AA content, capable of efficiently converting diverse waste materials into a valuable protein resource with customized AA composition, which could be used to replace fishmeal without compromising the performance of fish.
2 Materials and methods
Insect rearing
The BSFL were collected at Tsukuba, Ibaraki, Japan, in 2013, and the colony has been maintained at The Institute of Agrobiological Sciences, National Agriculture and Food Research Organization (1-2 Owashi, Tsukuba, Ibaraki 305-0851, Japan) with the following protocol. Newly hatched neonates are fed artificial diet containing glucose (4.7% wt; Nacalai Tesque Inc., Kyoto, Japan), molasses (2.4% wt; Nippon Garlic Corporation, Gunma, Japan), dry yeast (5.5% wt; Kirin Brewery Company, Ltd., Tokyo, Japan), dry yeast (1.2% wt; Oriental Yeast Co., Ltd., Tokyo, Japan), cornmeal (6.3% wt; Sunny Maize Co., Ltd., Shizuoka, Japan), p-hydroxybenzoic acid methyl ester (0.1% wt; Sigma-Aldrich, St Louis, MO, USA), propionic acid (0.5% wt; Wako, Osaka, Japan), agar (0.3% wt, producer is unknown), and distilled water (79% wt) (adapted from Nishinokubi et al., 2006) in a plastic cup (130 mm ID × 100 mm height; 860 MB, Mienron Kasei, Osaka, Japan) until the prepupa stage. Prepupae are collected and moved to a new plastic container with wood meal for pupation. Larvae and pupae are kept at 27 ± 0.5 °C and 70 ± 5% RH in an incubator at 16L: 8D photoperiod. Adults are reared in a wooden mesh cage (500 × 500 × 1000 mm) in a greenhouse at 27 ± 3 °C and 60% ± 10% RH and are provided with water.
Identification of candidate NAT homologs involved in amino acid recovery
To identify NATs expressed in Malpighian tubules of BSFL, we dissected the whole gut (Wg, n = 3), midgut (Mg, n = 3), Malpighian tubules (Mt, n = 2), and white Malpighian tubules (Wt, n = 2) from 5th instar larvae, and also analysed larvae with the gut removed (Lgr, n = 1) and the heads of male (Mh, n = 2) and female (Fh, n = 2) adults. Total RNA was isolated with TRIzol Reagent (Thermo Fisher Scientific, Carlsbad, CA, USA) following the manufacturer’s protocol and sent to Macrogen Japan Corp. (Tokyo, Japan) for RNA sequencing (RNA-seq) analyses. Contigs were assembled from RNA-seq data in Trinity v. 2.11.0 and Salmon v. 0.14.1 software and was used to estimate expression. HMMER v.3.3.1 (http://hmmer.org/) was used to search homologues of NATs from the contigs. A phylogenetic analysis of HiNATs and NATs identified in other insects was conducted in MEGA v. 11.0.10 (http://www.megasoftware.net) with the neighbor-joining method, with a bootstrap value of 2000. The alignment of HiNATs with AaLeuT, a leucine transporter from Aquifex aeolicus, was conducted with Clustal omega (https://www.ebi.ac.uk/Tools/msa/clustalo/) and the visualization was adjusted manually in Jalview 2.11.2.6 (https://www.jalview.org/).
Synthesis of double-stranded RNA (dsRNA)
dsRNA was synthesized with the T7 RiboMAX™ Express RNAi System (Promega Corporation, Madison, WI, USA) according to the manufacturer’s protocol. Primers (HiNATt-F: GCCAAGCTTTCTTTTCGATG; HiNATt-R: ACCAATATTGCTGCCAAAGG; HiNATg-F: TAAGCGCCATCAAAGATGC; HiNATg-R: CGTGATCTATGGGGGAAAGA; egfp-F: AAGTTCAGCGTGTCCGGCGA; egfp-R: GAAGTTCACCTTGATGCCGTT) were designed to match the sequences of the identified HiNATs (XP_037917479.1 and XP_037916662.1) and egfp (A green fluorescent protein identified from the crystal jelly, Aequorea victoria, MN517551.1). Synthesized dsRNAs (dsHiNATt, dsHiNATg, and dsegfp as a control) were adjusted to 2 μg/μL before injection.
RNA interference
Seven-day-old BSFL were rinsed with distilled water, gently wiped, anesthetized on ice for 20 min, and injected with 1 μL of dsRNA by using a syringe (1701RN, Neuros syringe with a pst-4 needle, Hamilton Company, Reno, NV, USA). The needle tip penetrated the cuticle between the segments on the side of the body without damaging organs. The larva was placed in a 1.5-mL centrifuge tube at 25 °C for 30 min to confirm survival. Artificial diet (0.5 mL) was added to the tubes with surviving larvae, and the tubes were kept under the conditions described in the insect rearing subsection. The BSFL weight was recorded on the 3rd, 6th, and 14th day after injection. The knockdown efficacy was evaluated by quantitative real-time PCR (qRT-PCR). Amino acids were analysed in the 14th-day larvae.
qRT-PCR analysis
Total RNA was isolated from the 3rd- and 6th-day RNAi-larvae with TRIzol as described above. To synthesize cDNA, total RNA (8 μL, ca. 500 ng) was mixed with 2 μL of PrimeScript™ RT Master Mix (Takara Bio, Kusatsu, Japan) and incubated at 37 °C for 15 min, followed by 85 °C for 5 s to inactivate the reverse transcriptase. For qPCR amplification, cDNA (2 μL) was mixed with forward and reverse primers (1 μL each), TB Green Premix Ex Taq II (12.5 μL; Takara Bio), and nuclease-free water (8.5 μL). The amplification was started at 95 °C for 30 s, followed by a thermal sequence of 95 °C for 5 s and 60 °C for 30 s, in a Roche LightCycler 96 system (Roche Diagnostics, Penzberg, Germany). Actin was used as a reference sequence to calculate the 2−ΔΔCT value (Gao et al., 2019).
Defatting, hydrolysis, and derivatization for amino acid analysis
Each BSFL was snap-frozen in liquid nitrogen and milled into fine meal in a stainless mortar (φ58 × 55 mm; ITO Seisakusho Co, Mie, Japan), and kept at −80 °C for 1 h. The meal was freeze-dried for 24 h and then defatted: in brief, BSFL meal (<50 mg) was vortexed with 1 mL of hexane in a 1.5-mL centrifuge tube for 40 min at 25 °C and centrifuged at 2,300
Amino acid analysis
Statistical analysis
The body weight and the content of each AA in BSFL were analysed with ANOVA, followed by Tukey’s HSD test, and the total AA content was analysed with the Kruskal-Wallis one-way ANOVA followed by Dunn’s test. The expression of HiNATs was analysed with Student’s t-test. All analyses were conducted using R (v4.3.0, https://www.r-project.org/).
3 Results
Identification of candidate genes involved in amino acid excretion
We identified five NATs of the SLC6 family and named them on the basis of their subfamily and tissue specificity (Figures 2a, 3). One transporter was highly expressed in the adults’ heads (Mh, Fh), one in the midgut, and one in the Malpighian tubules (Mt) (Figure 3). The transporters were named as follows: NAT with the highest expression in the midgut, HiNATg (XP_037917479.1); the Mt-specific NAT, HiNATt (XP_037916662.1); the NAT with the highest expression in the head, HiNATh (XP_037926594.1) (Figure 2). The other two NATs were named HiBLOT (orphan transporter, XP_037904554.1) and HiSERT (neurotransmitter transporter, XP_037917149.1) based on phylogenetic analysis (Figure 2). BSFL has two types of Mt (Figure 1b), one translucent, as in most insects, and the other filled with abundant soft white ingredients, named Wt (for ‘white Mt’). Notably, the expression of HiNATt was much lower in Wt than in Mt (Figure 3).
Phylogenetic trees of SLC6 transporters of different sub-families from Aedes aegypti (Ae), Anopheles gambiae (Ag), Bombyx mori (Bm), Danaus plexippus plexippus (Dp), Drosophila melanogaster (Dm), Hermetia illucens (Hi), Manduca sexta (Ms), Trichoplusia ni (Tn), and Tribolium castaneum (Tc). The BLOT, NAT, AAT, INE, and SERT represent different subfamilies in SLC6, W, M, F, and B0 – like represent the different substrate specificities. The selection of SLC6 transporter sequences was based on Fu et al. (2015) and Tang et al. (2016).
Citation: Journal of Insects as Food and Feed 2024; 10.1163/23524588-00001155
Expression of NATs in different tissues of H. illucens larvae. Wg, whole gut; Mg, midgut; Mt, Malpighian tubules; Wt, white Malpighian tubules; Lgr, larvae with gut removed; Mh, male heads; Fh, female heads. BLOT: the bloated tubules; SERT: the serotonin transporter; Transcripts per million, a read count of the target RNA normalized to 1 million read counts for all RNAs in the same sample.
Citation: Journal of Insects as Food and Feed 2024; 10.1163/23524588-00001155
To clarify the structure of HiNATs, an alignment with AaLeuT, a leucine transporter from Aquifex aeolicus whose structure has been confirmed by Yamashita et al. (2005), indicated that HiNATs have 12 transmembrane domains (TMs) and their substrate-binding sites are located in TM1, TM3, TM6, and TM8, which share a highly conserved sequence with AaLeuT (Supplementary Figure S1). Furthermore, the alignment of AA-and ion-binding sites indicated that HiNATh is closely related to AeAAT1 (Figure 2), a transporter from the yellow fever mosquito Aedes aegypti with high affinity for phenylalanine (Boudko, 2012). HiNATg was found to be closely related to mosquito AA transporters AeNAT8, AgNAT8, and CqNAT8, which have high affinity for phenylalanine. Remarkably, HiNATt was not closely related to any functionally characterized NAT group, so it could be a novel unique NAT (Figure 2).
RNA interference (RNAi) of HiNATt and HiNATg
To investigate the functions of HiNATs in AA allocation, we injected dsHiNATt, dsHiNATg, or dsegfp (control) into 7-day-old BSFL (BSFLHiNATt−, BSFLHiNATg−, and BSFLegfp− hereafter) and evaluated the effects 14 days later. The survival rate was 75% for BSFLegfp− and BSFLHiNATt− and 91.7% for BSFLHiNATg−. BSFLHiNATt− tended to be smaller than the control. The fresh (dry) weight was 210.0 ± 27.1 (60.5 ± 4.3) mg for BSFLegfp−, 106.6 ± 58.3 (36.4 ± 9.3) mg for BSFLHiNATg−, and 118.0 ± 21.9 (37.5 ± 2.7) mg for BSFLHiNATt− (Figure 4a, b). In comparison with BSFLegfp−, the expression of HiNATg was 34.9% in BSFLHiNATg− and that of HiNATt was 32.0% in BSFLHiNATt− (Figure 4c, d).
The performance of H. illucens larvae 14 days after dsRNA injection. (A) Body weight, (B) body size (n = 4), and expression of (C) dsHiNATg (n = 4) and (D) dsHiNATt (n = 4). Different letters above bars indicate significant difference (
Citation: Journal of Insects as Food and Feed 2024; 10.1163/23524588-00001155
Amino acid composition of BSFL after RNAi
To determine whether the knockdown of NATs affects AA content and composition in BSFL, we analysed samples of individuals. Total AA content was 4.41 ± 1.25 μg in BSFLHiNATt−, followed by 2.49 ± 0.22 μg in BSFLegfp− and 2.15 ± 1.36 μg in BSFLHiNATg− (
The AA content in individual H. illucens larvae 14 days after dsRNA injection. (A) Total AA content, and (B) contents of each AAs. Different letters above bars indicate significant difference (n = 3,
Citation: Journal of Insects as Food and Feed 2024; 10.1163/23524588-00001155
4 Discussion and conclusion
The method we described in this study represents a ground-breaking departure from previous research. Other approaches to enhancing the productivity of protein in BSFL have primarily focused on manipulating growth hormones to increase larval body size and growth rate (Gruber and Melton, 2023; Kou et al., 2022; Zhan et al., 2020). In contrast, our study introduces a novel strategy: the regulation of membrane transport within the excretory system to significantly boost the total protein content per individual larva. We identified NATs in BSFL and confirmed the function of HiNATg and HiNATt by RNAi experiments. Knockdown of HiNATg and HiNATt affected body weight and the composition of essential AAs. Total content of essential AAs was decreased in BSFLHiNATg− and increased in BSFLHiNATt−. Furthermore, the AA composition in BSFL was altered, with a notable increase in valuable essential AAs such as histidine, valine, and methionine (with marginal significance). These findings suggest the feasibility of improving the AA composition to align with the dietary requirements of animals.
The AA specificity of NATs may be broad substrate spectrum (e.g. AgNAT1 and DmNAT1 in Figure 2) or narrow substrate spectrum (e.g. AeAAT1, phenylalanine; AgNAT6, tryptophan in Figure 2) (Boudko, 2012; Boudko et al., 2005; Meleshkevitch et al., 2009; Miller et al., 2008). The substrate transport efficiency of NATs depends on the 3D structure of the substrate-binding pocket, and the diversity of the AA residues at the substrate-binding sites indicates the potential to adjust AA specificity through genetic modifications. Although HiNATt could not be classified as any of the functionally characterized NATs, it shares the same branch with NATs exhibiting narrow AA specificity, such as AeNAT8 and AgNAT8, suggesting that the AA specificity of HiNATt might be narrow (Figure 2A). Narrow AA specificities of HiNATg and HiNATt may explain the observed changes in the content of certain AAs after HiNAT knockdown. The AA content of BSFL can be affected not only by substrate specificities of NATs but also by synergism between NATs, AA homeostasis, or both (Bröer and Bröer, 2017; Okech et al., 2008). However, the Diptera (including BSF) lack the key enzyme histidine ammonia-lyase for histidine degradation (Zdobnov et al., 2002), indicating that the observed changes in histidine content after RNAi may be attributed to the potential role of both HiNATg and HiNATt in histidine transport.
The AA composition of BSFL can be adjusted by combining different ingredients to their diet. For example, BSFL fed on chicken manure and spent grain had higher crude protein content than those fed on kitchen waste, and glutamic acid was detected only in the latter (Shumo et al., 2019). However, fine-tuning the content of one or a few specific AAs in BSFL with this method is challenging (Fuso et al., 2021; Liland et al., 2017; Nogales-Mérida et al., 2019; Shumo et al., 2019). Moreover, the lack of histidine ammonia-lyase in BSF limits the options for increasing the histidine content (Gramazio et al., 2020). Here, we propose a novel approach to ‘lock’ histidine in BSFL by modifying their excretion system, which has not been previously considered. A strategy based on NAT knockdown has been applied to the case of the Colorado potato beetle, Leptinotarsa decemlineata, an invasive species that severely damages potato leaves and tubers. In this species, the knockdown of LdNAT1, a NAT found in the alimentary canal (mainly midgut), decreased the absorption of several important AAs, hampering larval growth and metamorphosis (Fu et al., 2015). Similarly, a reduction in body weight was observed in HiNATg- and HiNATt-silenced BSFL, with a lower amount of histidine detected in HiNATg-silenced BSFL. However, HiNATt-silenced BSFL showed a higher histidine content. These data suggest that manipulating the expression of HiNATt could be a promising technique for manipulating the AA content in BSFL. Further research on elucidating the transport efficiency of HiNAT could contribute to our understanding of how they influence the distribution of AAs in BSFL and enable us to fine-tune the AA composition by manipulating HiNAT.
The daily feed provided to animals should contain adequate amounts of essential AAs with a suitable composition to optimize their performance (Nogales-Mérida et al., 2019). Certain AAs, such as methionine, histidine, and valine, are typically regarded as essential for animals (Wu et al., 2014). Methionine is a major sulphur donor and is often considered as the first limiting AA; in comparison with a control diet, a high-methionine diet significantly improves the performance of broiler chickens (Bunchasak, 2009; Majdeddin et al., 2019). Histidine plays a vital role in the synthesis of carnosine and histamine, which are positively associated with food intake and animal growth (Moro et al., 2020). Histidine supplementation in feed enhances the growth of piglets and fish, and improves the meat quality of chickens (Figueroa et al., 2003; Michelato et al., 2017; Moro et al., 2020). Valine, a branched-chain AA (BCAA), contributes to muscle protein synthesis, and a high level of BCAAs in diet can enhance animal performance (Cemin et al., 2019; Gorissen and Phillips, 2018; Kerkaert et al., 2021). A diet with a high valine-to-lysine ratio improves mammary gland development in gilts, while sows fed a high-BCAA diet produce high-quality milk, thereby enhancing the growth of their piglets (Che et al., 2020; Rezaei et al., 2022). An increase in histidine, valine, and methionine contents could make BSFL an ideal protein source for animals. In nutritional aspect, an increase in histidine, valine, and methionine contents could make BSFL a more suitable protein source for animals.
A considerable proportion of fishmeal is consumed by the aquaculture industry, so the substitution of fishmeal with BSF-based meal may help establish a sustainable aquaculture system (Henry et al., 2015; Weththasinghe et al., 2022). However, replacing fishmeal with BSF-based meal can decrease performance in some species, which might due to the lower content of some essential AAs in BSF-based meal than in fishmeal (Henry et al., 2015; Limbu et al., 2022; Weththasinghe et al., 2022). Consequently, supplementation with essential AAs would be necessary to fulfil the needs of fish (Belghit et al., 2018; Józefiak et al., 2019). This approach has the potential to elevate the levels of essential AAs such as histidine and valine, thereby improving the AA score-a critical indicator of protein quality in food or feed. We have successfully identified new genetic targets with the potential to improve the nutritional profile of BSFL. However, when applying biotechnology in animal production, ethical issues related to the animal integrity, death, and naturalness should be carefully discussed (Hauskeller, 2007; Van Huis, 2021; Gjerris et al., 2016). For instance, the hormone levels and the pupation rate were largely affected by silencing a broad substrate spectrum NAT, LdNAT1 from L. decemlineata (Fu et al., 2015). Currently, the decreased weight seems to be the phenotype of HiNATt-silenced BSFL, but other physiological traits such as the hormone or metamorphosis of HiNATt-silenced BSF are still unclear. On the other hand, the nutritional plasticity of BSF might increase the difficulty and complexity in evaluating the ethical boundaries in regular BSF production or breeding BSF with biotechnological tools. For instance, the performance, such as the survival rate of BSFL, could be related to the concentration of protein in larval diet (Barragan-Fonseca et al., 2021). And collecting the phycological traits from HiNATt-silenced or -removed BSF might help us to clarify the importance of each AA on BSF biology and to establish the ethical boundaries in insect industry.
Equipped with a comprehensive dataset of genomic information, precise target sequences, and well-established rearing protocols, we are strategically positioned to employ genome editing technologies. Our future research endeavours will focus on developing stable, genetically-engineered breeding lines that consistently exhibit these improved nutritional characteristics with a normal body size. This integrated approach not only promises to advance the field of insect biotechnology but also holds great potential for the sustainable production of BSF-based products with improved nutritional value under an ethical framework.
Corresponding author; e-mail: ryuk146@affrc.go.jp
Supplementary material
Supplementary material is available online at: https://doi.org/10.6084/m9.figshare.26924941
Acknowledgements
This work was supported by the Cabinet Office, Government of Japan, Moonshot R&D Program for Agriculture, Forestry and Fisheries (funding agency: Bio-oriented Technology Research Advancement Institution). We thank Dr Cheng-Lung Tsai for advising on the construction of phylogenetic trees, and members of the Insect Design Technology Group for maintaining the insect colony.
Author contributions
C.-M. Liu contributed conceptualization, bioinformatics, experiments, chemical and statistical analysis, visualization, writing, and editing. M. Shimoda contributed conceptualization and editing. T. Uehara contributed bioinformatics, visualization, and editing.
Conflict of interests
The authors have no conflict of interests to declare.
Data availability
Raw RNA sequencing data have been uploaded to the DNA Data Bank of Japan under BioProject IDs.
References
Abd El-Hack, M.E., Shafi, M.E., Alghamdi, W.Y., Abdelnour, S.A., Shehata, A.M., Noreldin, A.E., Ashour, E.A., Swelum, A.A., Al-sagan, A.A., Alkhateeb, M., Taha, A.E., Abdel-moneim, A.M.E., Tufarelli, V. and Ragni, M., 2020. Black soldier fly (Hermetia illucens) meal as a promising feed ingredient for poultry: a comprehensive review. Agriculture 10: 1-31.
Attivi, K., Agboka, K., Mlaga, G.K., Oke, O.E., Teteh, A., Onagbesan, O. and Tona, K., 2020. Effect of black soldier fly (Hermetia illucens) maggots meal as a substitute for fish meal on growth performance, biochemical parameters and digestibility of broiler chickens. International Journal of Poultry Science 19: 75-80.
Attivi, K., Mlaga, K.G., Agboka, K., Tona, K., Kouame, Y.A.E. and Lin, H., 2022. Effect of fish meal replacement by black soldier fly (Hermetia illucens) larvae meal on serum biochemical indices, thyroid hormone and zootechnical performance of laying chickens. Journal of Applied Poultry Research 31: 100275.
Barragan-Fonseca, K.B., Gort, G., Dicke, M. and Van Loon, J.J.A., 2021. Nutritional plasticity of the black soldier fly (Hermetia illucens) in response to artificial diets varying in protein and carbohydrate concentrations. Journal of Insects as Food and Feed 7: 51-61. https://doi.org/10.3920/jiff2020.0034
Belghit, I., Liland, N.S., Waagbø, R., Biancarosa, I., Pelusio, N., Li, Y., Krogdahl, Å. and Lock, E.J., 2018. Potential of insect-based diets for Atlantic salmon (Salmo salar). Aquaculture 491: 72-81.
Biasato, I., Renna, M., Gai, F., Dabbou, S., Meneguz, M., Perona, G., Martinez, S., Lajusticia, A.C.B., Bergagna, S., Sardi, L., Capucchio, M.T., Bressan, E., Dama, A., Schiavone, A. and Gasco, L., 2019. Partially defatted black soldier fly larva meal inclusion in piglet diets: effects on the growth performance, nutrient digestibility, blood profile, gut morphology and histological features. Journal of Animal Science and Biotechnology 10: 12. https://doi.org/10.1186/s40104-019-0325-x
Boudko, D.Y., 2012. Molecular basis of essential amino acid transport from studies of insect nutrient amino acid transporters of the SLC6 family (NAT-SLC6). Journal of Insect Physiology 58: 433-449. https://doi.org/10.1016/j.jinsphys.2011.12.018
Boudko, D.Y., Kohn, A.B., Meleshkevitch, E.A., Dasher, M.K., Seron, T.J., Stevens, B.R. and Harvey, W.R., 2005. Ancestry and progeny of nutrient amino acid transporters. Proceedings of the National Academy of Sciences 102: 1360-1365.
Bröer, S. and Bröer, A., 2017. Amino acid homeostasis and signalling in mammalian cells and organisms. Biochemical Journal 474: 1935-1963.
Bunchasak, C., 2009. Role of dietary methionine in poultry production. Journal of Poultry Science 46: 169-179.
Cemin, H.S., Tokach, M.D., Woodworth, J.C., Dritz, S.S., DeRouchey, J.M. and Goodband, R.D., 2019. Branched-chain amino acid interactions in growing pig diets. Translational Animal Science 3: 1246-1253.
Che, L., Xu, M., Gao, K., Wang, L., Yang, X., Wen, X., Xiao, H. and Jiang, Z., 2020. Effects of dietary valine supplementation during late gestation on the reproductive performance and mammary gland development of gilts. Journal of Animal Science and Biotechnology 11: 15. https://doi.org/10.1186/s40104-019-0420-z
Chia, S.Y., Tanga, C.M., Osuga, I.M., Alaru, A.O., Mwangi, D.M., Githinji, M., Dubois, T., Ekesi, S., van Loon, J.J.A. and Dicke, M., 2021. Black soldier fly larval meal in feed enhances growth performance, carcass yield and meat quality of finishing pigs. Journal of Insects as Food and Feed 7: 433-447. https://doi.org/10.3920/JIFF2020.0072
EU, 2021. Commission Regulation (EU) 2021/1372 of 17 August 2021 amending Annex IV to Regulation (EC) No 999/2001 of the European Parliament and of the Council as regards the prohibition to feed non-ruminant farmed animals, other than fur animals, with protein deri. Official Journal of the European Union 64: 1-21.
Figueroa, J.L., Lewis, A.J., Miller, P.S., Fischer, R.L. and Diedrichsen, R.M., 2003. Growth, carcass traits, and plasma amino acid concentrations of gilts fed low-protein diets supplemented with amino acids including histidine, isoleucine, and valine. Journal of Animal Science 81: 1529-1537.
Fu, K.Y., Guo, W.C., Ahmat, T. and Li, G.Q., 2015. Knockdown of a nutrient amino acid transporter gene LdNAT1 reduces free neutral amino acid contents and impairs Leptinotarsa decemlineata pupation. Scientific Reports 5: 18124. https://doi.org/10.1038/srep18124
Fuso, A., Barbi, S., Macavei, L.I., Luparelli, A.V., Maistrello, L., Montorsi, M., Sforza, S. and Caligiani, A., 2021. Effect of the rearing substrate on total protein and amino acid composition in black soldier fly. Foods 10: 1773. https://doi.org/10.3390/foods10081773
Gao, Z., Deng, W. and Zhu, F., 2019. Reference gene selection for quantitative gene expression analysis in black soldier fly (Hermetia illucens). PLOS ONE 14. https://doi.org/10.1371/journal.pone.0221420
Gjerris, M., Gamborg, C. and Röcklinsberg, H., 2016. Ethical aspects of insect production for food and feed. Journal of Insects as Food and Feed 2: 101-110. https://doi.org/10.3920/JIFF2015.0097
Gold, M., Tomberlin, J.K., Diener, S., Zurbrügg, C. and Mathys, A., 2018. Decomposition of biowaste macronutrients, microbes, and chemicals in black soldier fly larval treatment: a review. Waste Management 82: 302-318.
Gorissen, S.H.M. and Phillips, S.M., 2018. Branched-chain amino acids (leucine, isoleucine, and valine) and skeletal muscle. Nutrition and Skeletal Muscle 2019: 283-298. https://doi.org/10.1016/B978-0-12-810422-4.00016-6
Gramazio, P., Takayama, M. and Ezura, H., 2020. Challenges and prospects of new plant breeding techniques for GABA improvement in crops: tomato as an example. Frontiers in Plant Science 11: 1-16.
Gruber, K. and Melton, L., 2023. CRISPR upgrades insect proteins for feed. Nature Biotechnology 41: 1038-1040. https://doi.org/10.1038/s41587-023-01902-9
Hauskeller, M., 2007. Biotechnology and the integrity of life. Taking public fears seriously. Ashgate Publishing Ltd, Farnham, UK.
Henry, M., Gasco, L., Piccolo, G. and Fountoulaki, E., 2015. Review on the use of insects in the diet of farmed fish: past and future. Animal Feed Science and Technology 203: 1-22.
Józefiak, A., Nogales-Mérida, S., Mikołajczak, Z., Rawski, M., Kierończyk, B. and Mazurkiewicz, J., 2019. The utilization of full-fat insect meal in rainbow trout (Oncorhynchus mykiss) nutrition: the effects on growth performance, intestinal microbiota and gastrointestinal tract histomorphology. Annals of Animal Science 19: 747-765.
Kerkaert, H.R., Cemin, H.S., Woodworth, J.C., Derouchey, J.M., Dritz, S.S., Tokach, M.D., Goodband, R.D., Haydon, K.D., Hastad, C.W. and Post, Z.B., 2021. Improving performance of finishing pigs with added valine, isoleucine, and tryptophan: validating a meta-analysis model. Journal of Animal Science 99: skab006. https://doi.org/10.1093/jas/skab006
Kou, Z., Luo, X., Jiang, Y., Chen, B., Song, Y., Wang, Y., Xu, J., Tomberlin, J.K. and Huang, Y., 2022. Establishment of highly efficient transgenic system for black soldier fly (Hermetia illucens). Insect Science 30: 888-900. https://doi.org/10.1111/1744-7917.13147
Lalander, C., Diener, S., Zurbrügg, C. and Vinnerås, B., 2019. Effects of feedstock on larval development and process efficiency in waste treatment with black soldier fly (Hermetia illucens). Journal of Cleaner Production 208: 211-219.
Liland, N.S., Biancarosa, I., Araujo, P., Biemans, D., Bruckner, C.G., Waagbø, R., Torstensen, B.E. and Lock, E.J., 2017. Modulation of nutrient composition of black soldier fly (Hermetia illucens) larvae by feeding seaweed-enriched media. PLOS ONE 12: 1-23.
Limbu, S.M., Shoko, A.P., Ulotu, E.E., Luvanga, S.A., Munyi, F.M., John, J.O. and Opiyo, M.A., 2022. Black soldier fly (Hermetia illucens, L.) larvae meal improves growth performance, feed efficiency and economic returns of Nile tilapia (Oreochromis niloticus, L.) fry. Aquaculture, Fish and Fisheries 2: 167-178.
Lu, S., Taethaisong, N., Meethip, W., Surakhunthod, J., Sinpru, B., Sroichak, T., Archa, P., Thongpea, S., Paengkoum, S., Purba, R.A.P. and Paengkoum, P., 2022. Nutritional composition of black soldier fly larvae (Hermetia illucens L.) and its potential uses as alternative protein sources in animal diets: a review. Insects 13: 831. https://doi.org/10.3390/insects13090831
Majdeddin, M., Golian, A., Kermanshahi, H., Michiels, J. and De Smet, S., 2019. Effects of methionine and guanidinoacetic acid supplementation on performance and energy metabolites in breast muscle of male broiler chickens fed corn-soybean diets. British Poultry Science 60: 554-563.
Meleshkevitch, E.A., Robinson, M., Popova, L.B., Miller, M.M., Harvey, W.R. and Boudko, D.Y., 2009. Cloning and functional expression of the first eukaryotic Na+-tryptophan symporter, AgNAT6. Journal of Experimental Biology 212: 1559-1567.
Michelato, M., Zaminhan, M., Boscolo, W.R., Nogaroto, V., Vicari, M., Artoni, R.F., Furuya, V.R.B. and Furuya, W.M., 2017. Dietary histidine requirement of Nile tilapia juveniles based on growth performance, expression of muscle-growth-related genes and haematological responses. Aquaculture 467: 63-70.
Miller, M.M., Popova, L.B., Meleshkevitch, E.A., Tran, P.V. and Boudko, D.Y., 2008. The invertebrate B0 system transporter, D. melanogaster NAT1, has unique d-amino acid affinity and mediates gut and brain functions. Insect Biochemistry and Molecular Biology 38: 923-931.
Moro, J., Tomé, D., Schmidely, P., Demersay, T.C. and Azzout-Marniche, D., 2020. Histidine: a systematic review on metabolism and physiological effects in human and different animal species. Nutrients 12: 1414. https://doi.org/10.3390/nu12051414
Nishinokubi, I., Shimoda, M. and Ishida, N., 2006. Mating rhythms of Drosophila: rescue of tim01 mutant by D. ananassae timeless. Journal of Circadian Rhythms 4: 4. https://doi.org/10.1186/1740-3391-4-4
Nogales-Mérida, S., Gobbi, P., Józefiak, D., Mazurkiewicz, J., Dudek, K., Rawski, M., Kierończyk, B. and Józefiak, A., 2019. Insect meals in fish nutrition. Reviews in Aquaculture 11: 1080-1103.
Okech, B.A., Meleshkevitch, E.A., Miller, M.M., Popova, L.B., Harvey, W.R. and Boudko, D.Y., 2008. Synergy and specificity of two Na+-aromatic amino acid symporters in the model alimentary canal of mosquito larvae. Journal of Experimental Biology 211: 1594-1602.
Parodi, A., Leip, A., De Boer, I.J.M., Slegers, P.M., Ziegler, F., Temme, E.H.M., Herrero, M., Tuomisto, H., Valin, H., Van Middelaar, C.E., Van Loon, J.J.A. and Van Zanten, H.H.E., 2018. The potential of future foods for sustainable and healthy diets. Nature Sustainability 1: 782-789.
Rezaei, R., Gabriel, A.S. and Wu, G., 2022. Dietary supplementation with branched-chain amino acids enhances milk production by lactating sows and the growth of suckling piglets. Journal of Animal Science and Biotechnology 13: 65. https://doi.org/10.1186/s40104-022-00718-y
Schiavone, A., De Marco, M., Martı́nez, S., Dabbou, S., Renna, M., Madrid, J., Hernandez, F., Rotolo, L., Costa, P., Gai, F. and Gasco, L., 2017. Nutritional value of a partially defatted and a highly defatted black soldier fly larvae (Hermetia illucens L.) meal for broiler chickens: apparent nutrient digestibility, apparent metabolizable energy and apparent ileal amino acid digestibility. Journal of Animal Science and Biotechnology 8: 51. https://doi.org/10.1186/s40104-017-0181-5
Shumo, M., Osuga, I.M., Khamis, F.M., Tanga, C.M., Fiaboe, K.K.M., Subramanian, S., Ekesi, S., van Huis, A. and Borgemeister, C., 2019. The nutritive value of black soldier fly larvae reared on common organic waste streams in Kenya. Scientific Reports 9: 10110. https://doi.org/10.1038/s41598-019-46603-z
Tang, X., Liu, H., Chen, Q., Wang, X., Xiong, Y. and Zhao, P., 2016. Genome-wide identification, characterization and expression analysis of the solute carrier 6 gene family in silkworm (Bombyx mori). International Journal of Molecular Sciences 17: 1675. https://doi.org/10.3390/ijms17101675
Tschirner, M. and Simon, A., 2015. Influence of different growing substrates and processing on the nutrient composition of black soldier fly larvae destined for animal feed. Journal of Insects as Food and Feed 1: 249-259. https://doi.org/10.3920/JIFF2014.0008
Van Huis, A., 2021. Welfare of farmed insects. Journal of Insects as Foodand Feed 7: 573-584. https://doi.org/10.3920/JIFF2020.0061.573
Wang, Y.S. and Shelomi, M., 2017. Review of black soldier fly (Hermetia illucens) as animal feed and human food. Foods 6: 91. https://doi.org/10.3390/foods6100091
Weththasinghe, P., Hansen, J.Ø., Mydland, L.T. and Øverland, M., 2022. A systematic meta-analysis based review on black soldier fly (Hermetia illucens) as a novel protein source for salmonids. Reviews in Aquaculture 14: 938-956.
Wu, G., Bazer, F.W., Dai, Z., Li, D., Wang, J. and Wu, Z., 2014. Amino acid nutrition in animals: protein synthesis and beyond. Annual Review of Animal Biosciences 2: 387-417.
Yamamoto, T., Matsunari, H., Oku, H., Murashita, K., Yoshinaga, H. and Furuita, H., 2019. Supplemental effects of histidine to fishmeal-based and low-fishmeal diets on the growth performance and tissue free amino acid levels of fingerling yellowtail Seriola quinqueradiata. Aquaculture Science 67: 367-375. https://doi.org/10.11233/aquaculturesci.67.367
Yamashita, A., Singh, S.K., Kawate, T., Jin, Y. and Gouaux, E., 2005. Crystal structure of a bacterial homologue of Na+/Cl−-dependent neurotransmitter transporters. Nature 437: 215-223. https://doi.org/10.1038/nature03978
Zdobnov, E.M., Von Mering, C., Letunic, I., Torrents, D., Suyama, M., Copley, R.R., Christophides, G.K., Thomasova, D., Holt, R.A., Subramanian, G.M., Mueller, H.M., Dimopoulos, G., Law, J.H., Wells, M.A., Birney, E., Charlab, R., Halpern, A.L., Kokoza, E., Kraft, C.L., Lai, Z., Lewis, S., Louis, C., Barillas-Mury, C., Nusskern, D., Rubin, G.M., Salzberg, S.L., Sutton, G.G., Topalis, P., Wides, R., Wincker, P., Yandell, M., Collins, F.H., Ribeiro, J., Gelbart, W.M., Kafatos, F.C. and Bork, P., 2002. Comparative genome and proteome analysis of Anopheles gambiae and Drosophila melanogaster. Science 298: 149-159.
Zhan, S., Fang, G., Cai, M., Kou, Z., Xu, J., Cao, Y., Bai, L., Zhang, Y., Jiang, Y., Luo, X., Xu, J., Xu, X., Zheng, L., Yu, Z., Yang, H., Zhang, Z., Wang, S., Tomberlin, J.K., Zhang, J. and Huang, Y., 2020. Genomic landscape and genetic manipulation of the black soldier fly Hermetia illucens, a natural waste recycler. Cell Research 30: 50-60.
Zulkifli, N.F.N.M., Seok-Kian, A.Y., Seng, L.L., Mustafa, S., Kim, Y.S. and Shapawi, R., 2022. Nutritional value of black soldier fly (Hermetia illucens) larvae processed by different methods. PLOS ONE 17: 1-14.
